COMRAD - Cattle Comparative Radiation Hybrid Map

Marker Table for Chromosome 9

Framework
markers
Marker IDPrimer 1Primer 2Retention
Frequency
Gene Names
F1 BM1227 CACCAGTGATATTGGCTTATGG GGAAGAAACACTTCCAAACCC 0.245   
F2 BM1545 CTTCCAAGGGATTCTTGCC AATGGGCGAATTTTGTTCAG 0.213   
F1 BM2504 CTCCCATCCCAAACACAGAC CAGCTTTCCATCCCCTTTC 0.261   
F2 BM4204 GGGTAGGAGCTTTTGTAGGTG GCCATCACCCTTCTCTTATATG 0.213   
 BM4208 TCAGTACACTGGCCACCATG CACTGCATGCTTTTCCAAAC 0.138   
 BM4627 TGAAGCAACTGGGTATGCAC AGGACAAGCTGGCTTCTGAG 0.181   
 BM6436 AAAGACTGCTTGCCTGAAGC CAACCAGTGATGCTGTACTCTG 0.149   
 BM6449 TATGTCCAGCAGCCCCTAAC ACTACAGAGCAACCATGCTGG 0.22   
 BM7209 TTTTCTGCTCATGCTTCAGTG GCAGGCTATAGTCCATGACATC 0.138   
 BM7234 TTCACTGATTGTCATTCCCTAGA TAAGCAAATAAATGGTGCTAGTCA 0.149   
 BM757 TTGAGCCACCAAGGAACC TGGAAACAATGTAAACCTGGG 0.287   
F2 BMS1148 TTAAATGGGACCAGATAAATAGGA AAATGAGAACCAGATAAGCCTAAA 0.149   
 BMS1234 CACCATTCATTCTTGTTTTGG GCACCTTTCACAAGTAGAACTGA 0.237   
 BMS1267 TTCTGAATTTGATTCCCAACA ACTGTTTCCTTAAAAGCTTCCC 0.207   
 BMS1290 TTGGCACTTACTACCTCATATGTT TTTTCTGGATGTTGAGCCTATT 0.154   
F3 BMS1319 TCTCTGTGTCCTCACAAAGGG ACATGTGTGCGTGCAAGTG 0.202   
 BMS1522 AGAAAATGATGGCAGGAACC AGTCCATGGTGTTGAAAGAGTC 0.217   
F1 BMS1694 ATGGACCTTCAAGAACAGAAGC CTAACAACACAACCCTTCCTCC 0.29   
 BMS1724 GACTTGCCCCAATCCTACTG ATTTCAGGTTTGTTGGTTCCC 0.149   
 BMS1943 ATCAGTCGTTCCCAGAATGTC TTGATATCCTCTCTGTCAAGCC 0.237   
F3 BMS1967 GGGCAGATGTGAGTAATTTTCC AACTGAGCTGTATGGTGGACG 0.25   
F3 BMS2063 AAGGGGAGGAGCTTAAGTAGG GAGAATCAGACATGAATGAGTACG 0.097   
 BMS2094 GGCTGTCCTGAGTCTTGTCTG AAAATCGGAACCAAACATTCC 0.341   
 BMS2151 CCATTAAGAGGAAATTGTGTTCA ATGGAGTCACTGAAAGGTACTGA 0.383   
 BMS2177 TTGCTAATGCAAATGTGTATGTG GATCATGTCATCTGTGAAAAAAGA 0.301   
 BMS2251 AACGGCTTTCACTTTCTTGC CTGGGTGAACAAATGGGC 0.183   
 BMS2295 GCTCTGGTGACCCAGGTG CTGGCAGGAGATGAGAGGAG 0.138   
 BMS2377 AACAGAGGAACCTGCCAGC ACTCCCTGGATGTGAATACTGG 0.138   
 BMS2753 TCAAAAAGTTGGACATGACTGA AGGTTTTCAAATGAGAGACTTTTC 0.096   
F3 BMS2819 GCTCACAGGTTCTGAGGACTC AACTTGAAGAAGGAATGCTGAG 0.085   
F2 BMS345 AGGTGAATAAACTTCAAGGAGAGC ATACACTTGCACATCAACCCA 0.172   
 BMS425 AAACCTGCCAAAGGAAACAC TATCTCCTGCTCCCATCTTTC 0.234   
 BMS434 GTTTCTCCTTTCCCCTCTGA TGACTTCAGGGAATAAGTTCCA 0.196   
 BMS47 CAGAGAGCGTCTGTGGAGG TCTTGTCTGGCTGGATGATG 0.242   
 BMS555 GGAAAGAGTAGGTGATTCCCTG ATTTAATTGTCATCCCAGGTGA 0.118   
F2 CSSM025 GTAGTTATCAAAATAAGAATGCTT TATGTTTTCCTTTTGGTTGAATAG 0.237   
F3 CSSM056 ATTTGACAGTTGAGGCATTGCTGA CAGTATCTCACTGACCCAGGTTTC 0.138   
F3 DIK096 GCTGTAATGAGGCACCACAATA GCTTGCAGACTCCCTCTCTC 0.096   
F1 ETH225 GATCACCTTGCCACTATTTCCT ACATGACAGCCAGCTGCTACT 0.255   
F1 ILSTS037 CGAAGAAGGACGCCTACAAG GATATTCGGGGAAACCCACT 0.209   
 ILSTS084 CTCAGGGGACAATCACAAGC CAAACCTACTAAGATGAAGTCC 0.196   
F3 ILSTS088 CATGCGGAATGTTCTTCACG ACATGACCACTGGAAAAACC 0.16   
 INRA084 CTAAAGCTTTCCTCCATCTC CCTGGTGATGTTTGGATGTC 0.096   
F1 INRA136 ACTCCAGTGTTTATTGCAGCG AGACCTTTCCTCTTTCTCAGGG 0.204   
 INRA144 TCGGTGTGGGAGGTGACTACAT TGCTGGTGGGCTCCGTCACC 0.108   
 MILSTS076 TGGCAGGCAGGTTCTTTAGC TTCAGATTCACTCAGACAGC 0.22   
 MM12E6 CAAGACAGGTGTTTCAATCT ATCGACTCTGGGGATGATGT 0.138   
F1 RM042 CCACCATTGAAGCACGTATAGCT CAGCTTAGCGACTAAACAACAAAT 0.258   
F2 TGLA261 CAAATCTCATTCTCTCCAGAAGGC CCAACTTATATTAGGCACAATGTCC 0.176   
 TGLA73 GAGAATCACCTAGAGAGGCA CTTTCTCTTTAAATTCTATATGGT 0.117   
F3 URB024 GACACCACCTAGCAACTGAACA CTGAAGCATCTGAATACTCTCC 0.14   
F3 URB028 GTATCAGTCTCTCTCAACAACCTT CATGTCAGGCATCAGTCCATAG 0.138   
F2 UWCA9 CCTTCTCTGAATTTTTGTTGAAAGC GGACAGAAGTGAGTGACTGAGA 0.194   
Markers below are Not included in the map
 BMC701 TGATTTCCTTTTCCAGACTTCC ATGGGTTCCAGCACAATTTT 0.323   
 BMS817 TGGGAAAGTTGGCAAATG TTGTGATACCTGAAATGGTCAA 0.183   
  • Back to the chromosome panel
  • Data from http://www.projects.roslin.ac.uk/comrad/introduction.html
  • Contact: Dr John Williams

  • Web Access Statistics © 2003-2020 NAGRP - U. S. Cattle Genome Research Coordination Program .
    Contact: The NAGRP Bioinformatics Team
    Helpdesk